Dear Chun-Ling Sun, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Chun-Ling Sun -- WBPerson7042 |
| Your E-mail Address | clsun@uw.edu |
| Allele Name | ok3234 -- WBVar00094297 |
| Gene Name | xdh-1 -- WBGene00010083 |
| Sequence Name | F55B11.1 |
| Type of Alteration | Insertion + Deletion |
| Alteration Details | 741 bp deletion |
| Type of Mutation | Frameshift |
| Mutation Details | cttttttttcagatacatatatcagacgatacaataatgatccaaacttatcaaaaatttcataaaagtttgaaacagaaaaataaacaaatttatctcatttcagTCAGTTGCTGGAAACATTGCAACAGCATCTCCAATCTCTGATCTCAATCCAATTTGGATGGCATCCAATGCATTGGTCGTTTTGGATTCAGAAGCCCGTGGTGAAAAACGAGTTCATATCGATGAGAAGTTCTTCTTGGGATACAGAAAAACCGTTATTCAACAGGATGAAATTATCAAGGCTGTCATTGTTCCGTTGTTGGAAGAAAATGAGCATTTTGCGGCTTACAAGCAGGCTCAACGACGAGAAGATGACATTGCAATTGTCACAGGAGCATTTTTGGTGAAGCTCGACCCGAAAACTTTGGTTGTTGAGAAAATTCGAATTTCCTACGGAGGAATGGCTCCAACTACTAAACTTGCACTGACTACAATGGAGAAGTTGATTGGAGAAAAGTGGTCTCAAACATTCCTGGATAAAGCTTTAGGACTTCTCAGTGATGAGTTAAAATTGCCAGCAGGTGTACCCGGAGGAATGTCACAATATCGTTTGTCACTTGCTCTTTCATTCTTCTTCAAATTCTTTTTGGGAGTTTCTAAGAAATTGGAACTTACTGAGATCAAATATGTAGATGCTGATGTGAAAATTGGACAGAATGTGCCAGAGACGTTGTATGCAACACAGCTTTATCAGgt |
| 30 bp upstream | GTATTCATGTCAGAAATGTTGCGgttagta |
| 30 bp downstream | atttttcactttaaaaattgagactgtatg |
| Strain | BR2379 |
| Genotype | xdh-1(ok3234) |
Dear Chonglin Yang, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Chonglin Yang -- WBPerson2241 |
| Your E-mail Address | clyang@ynu.edu.cn |
| PubMed ID | 40931112 |
| Allele Name | yq635 |
| Gene Name | immt-1 -- WBGene00020511 |
| Sequence Name | T14G11.3 |
| Type of Alteration | Insertion |
| Alteration Details | CRISPR knock in gfp on C-terminal |
| Mutation Details | C-terminal knock in of GFP at the gene locus |
| 30 bp upstream | 5'-CTAATAAGTTGAGCGAATCG-3' |
| 30 bp downstream | 5'-CCACAAGAAGCTGGGCGAGA-3' |
| Reverse genetics | PCR |
Dear Chonglin Yang, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Chonglin Yang -- WBPerson2241 |
| Your E-mail Address | clyang@ynu.edu.cn |
| PubMed ID | 40931112 |
| Allele Name | yq636 |
| Gene Name | larp-1 -- WBGene00020097 |
| Sequence Name | R144.7 |
| Type of Alteration | Insertion |
| Alteration Details | CRISPR knock in gfp on C-terminal |
| Mutation Details | C-terminal knock in of GFP at the gene locus |
| 30 bp upstream | 5'-GGTGAAAGTGATAGGAGGGA-3' |
| 30 bp downstream | 5'-GGTGAAAGTGATAGGAGGGA-3' |
| Reverse genetics | PCR |
Dear Chonglin Yang, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Chonglin Yang |
| Your E-mail Address | clyang@ynu.edu.cn |
| PubMed ID | 40931112 |
| Allele Name | yq636 |
| Gene Name | larp-1 |
| Sequence Name | R144.7 |
| Type of Alteration | Insertion |
| Alteration Details | CRISPR knock in gfp on C-terminal |
| Mutation Details | C-terminal knock in of GFP at the gene locus |
| 30 bp upstream | 5'-GGTGAAAGTGATAGGAGGGA-3' |
| 30 bp downstream | 5'-GGTGAAAGTGATAGGAGGGA-3' |
| Reverse genetics | PCR |
Dear Chonglin Yang, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Chonglin Yang -- WBPerson2241 |
| Your E-mail Address | clyang@ynu.edu.cn |
| PubMed ID | 40931112 |
| Allele Name | yq658 |
| Gene Name | tomm-20 -- WBGene00009092 |
| Sequence Name | F23H12.2 |
| Type of Alteration | Insertion |
| Alteration Details | CRISPR knock in gfp on C-terminal |
| Mutation Details | C-terminal knock in of GFP at the gene locus |
| 30 bp upstream | 5'-TGGTGGAGGTCCGTCTCCG-3' |
| 30 bp downstream | 5'-TGGTGGAGGTCCGTCTCCG-3' |
| Reverse genetics | PCR |
Dear Chonglin Yang, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Chonglin Yang -- WBPerson2241 |
| Your E-mail Address | clyang@ynu.edu.cn |
| PubMed ID | 40931112 |
| Allele Name | yq659 |
| Gene Name | chch-3 -- WBGene00010942 |
| Sequence Name | M176.3 |
| Type of Alteration | Insertion + Deletion |
| Alteration Details | CRISPR knock in gfp on C-terminal |
| Mutation Details | C-terminal knock in of GFP at the gene locus |
| 30 bp upstream | 5'-TCAGGCAACAAGTGCTCAA-3' |
| 30 bp downstream | 5'-AGGCATTCGAGAAATGTGT-3' |
| Reverse genetics | PCR |
Dear Chonglin Yang, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Chonglin Yang -- WBPerson2241 |
| Your E-mail Address | clyang@ynu.edu.cn |
| PubMed ID | 40931112 |
| Allele Name | yq660 |
| Gene Name | CELE_F54A3.5 -- WBGene00018784 |
| Sequence Name | F54A3.5 |
| Type of Alteration | Insertion |
| Alteration Details | CRISPR knock in gfp on C-terminal |
| Mutation Details | C-terminal knock in of GFP at the gene locus |
| 30 bp upstream | 5'-CGGTGATAATATTGTATGC-3' |
| 30 bp downstream | 5'-CAGCTGGACAGGATTCGCA-3' |
| Reverse genetics | PCR |
Dear Chonglin Yang, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Chonglin Yang -- WBPerson2241 |
| Your E-mail Address | clyang@ynu.edu.cn |
| PubMed ID | 40931112 |
| Allele Name | yq661 |
| Gene Name | CELE_W04C9.2 -- WBGene00021024 |
| Sequence Name | W04C9.2 |
| Type of Alteration | Insertion |
| 30 bp upstream | 5'-GAATACACGAGGATTCGGG-3' |
| 30 bp downstream | 5'-GAATACACGAGGATTCGGG-3' |
| Reverse genetics | PCR |
Dear Chonglin Yang, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Chonglin Yang -- WBPerson2241 |
| Your E-mail Address | clyang@ynu.edu.cn |
| PubMed ID | 40931112 |
| Allele Name | yq767 |
| Gene Name | moma-1 -- WBGene00019333 |
| Sequence Name | K02F3.10 |
| Type of Alteration | Insertion |
| Alteration Details | CRISPR knock in gfp on C-terminal |
| Mutation Details | C-terminal knock in of GFP at the gene locus |
| 30 bp upstream | 5'-TGACGATGGCAGATGGAGT-3' |
| 30 bp downstream | 5'-TGACGATGGCAGATGGAGT-3' |
| Reverse genetics | PCR |
Dear Chonglin Yang, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Chonglin Yang -- WBPerson2241 |
| Your E-mail Address | clyang@ynu.edu.cn |
| PubMed ID | 40931112 |
| Allele Name | yq638 |
| Gene Name | larp-1 -- WBGene00020097 |
| Sequence Name | R144.7 |
| Type of Alteration | Insertion |
| Alteration Details | CRISPR knock in APEX-2 on C-terminal |
| Mutation Details | CRISPR knock in APEX-2 on C-terminal |
| 30 bp upstream | 5'-GGTGAAAGTGATAGGAGGGA-3' |
| 30 bp downstream | 5'-GGTGAAAGTGATAGGAGGGA-3' |
| Reverse genetics | PCR |
Dear Chonglin Yang, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Chonglin Yang -- WBPerson2241 |
| Your E-mail Address | clyang@ynu.edu.cn |
| PubMed ID | 40931112 |
| Allele Name | yq662 |
| Gene Name | mdh-2 -- WBGene00003162 |
| Sequence Name | F20H11.3 |
| Type of Alteration | Insertion |
| Alteration Details | CRISPR knock in mKate2 on C-terminal |
| Mutation Details | CRISPR knock in mKate2 on C-terminal |
| 30 bp upstream | 5'-TTAACAAGAACATTGCCAA-3' |
| 30 bp downstream | 5'-TATCCATTACTCCAAGTCGT-3' |
| Reverse genetics | PCR |
Dear Chonglin Yang, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Chonglin Yang -- WBPerson2241 |
| Your E-mail Address | clyang@ynu.edu.cn |
| PubMed ID | 40931112 |
| Allele Name | yq640 -- WBVar02158193 |
| Gene Name | tomm-20 -- WBGene00009092 |
| Sequence Name | F23H12.2 |
| Type of Alteration | Insertion |
| Alteration Details | CRISPR knock in RFP-3ÃHA on C-terminal |
| Mutation Details | CRISPR knock in RFP-3ÃHA on C-terminal |
| 30 bp upstream | 5'-TATCCATTACTCCAAGTCGT-3' |
| 30 bp downstream | 5'-TATCCATTACTCCAAGTCGT-3' |
| Reverse genetics | PCR |
Dear Chonglin Yang, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Chonglin Yang |
| Your E-mail Address | clyang@ynu.edu.cn |
| PubMed ID | 40931112 |
| Allele Name | yq640 -- WBVar02158193 |
| Gene Name | tomm-20 |
| Sequence Name | F23H12.2 |
| Type of Alteration | Insertion |
| Alteration Details | CRISPR knock in RFP-3ÃHA on C-terminal |
| Mutation Details | CRISPR knock in RFP-3ÃHA on C-terminal |
| 30 bp upstream | 5'-TATCCATTACTCCAAGTCGT-3' |
| 30 bp downstream | 5'-TATCCATTACTCCAAGTCGT-3' |
| Reverse genetics | PCR |
Dear Chonglin Yang, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Chonglin Yang -- WBPerson2241 |
| Your E-mail Address | clyang@ynu.edu.cn |
| PubMed ID | 40931112 |
| Allele Name | yq763 |
| Gene Name | ife-4 -- WBGene00002062 |
| Sequence Name | C05D9.5 |
| Type of Alteration | Insertion |
| Alteration Details | CRISPR knock in RFP-3ÃHA on C-terminal |
| Mutation Details | CRISPR knock in RFP-3ÃHA on C-terminal |
| 30 bp upstream | 5'-GCTCCAACTGCCTCAGAACA-3' |
| 30 bp downstream | 5'-GCTCCAACTGCCTCAGAACA-3' |
| Reverse genetics | PCR |
Dear Chonglin Yang, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Chonglin Yang -- WBPerson2241 |
| Your E-mail Address | clyang@ynu.edu.cn |
| PubMed ID | 40931112 |
| Allele Name | yq766 |
| Gene Name | pab-1 -- WBGene00003902 |
| Sequence Name | Y106G6H.2 |
| Type of Alteration | Insertion |
| Alteration Details | CRISPR knock in RFP-3ÃHA on C-terminal |
| Mutation Details | CRISPR knock in RFP-3ÃHA on C-terminal |
| 30 bp upstream | 5'-ATGAACTTATTGCTTCTGAG-3' |
| 30 bp downstream | 5'-ATGAACTTATTGCTTCTGAG-3' |
| Production Method | CRISPR_Cas9 |
| Reverse genetics | PCR |
Dear Chonglin Yang, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Chonglin Yang -- WBPerson2241 |
| Your E-mail Address | clyang@ynu.edu.cn |
| PubMed ID | 40931112 |
| Allele Name | yq565 |
| Gene Name | larp-1 -- WBGene00020097 |
| Sequence Name | R144.7 |
| Type of Alteration | Point Mutation |
| Alteration Details | yq565 mutant containing a g.1214 A>T substitution in the larp-1 gene and a corresponding K286stop mutation in the LARP-1 protein |
| Mutation Details | yq565 mutant containing a g.1214 A>T substitution in the larp-1 gene and a corresponding K286stop mutation in the LARP-1 protein |
| 30 bp upstream | 5'-GTGTGCTGAACCTGCTGTGA-3' |
| 30 bp downstream | 5'-CGCTTCGTCTCCATCACAGC-3' |
| Reverse genetics | PCR |
Dear Chonglin Yang, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Chonglin Yang -- WBPerson2241 |
| Your E-mail Address | clyang@ynu.edu.cn |
| PubMed ID | 40931112 |
| Allele Name | yq663 |
| Gene Name | CELE_W04C9.2 -- WBGene00021024 |
| Sequence Name | W04C9.2 |
| Type of Alteration | Point Mutation |
| Alteration Details | Loss of W04C9.2 |
| Mutation Details | W23stop |
| 30 bp upstream | 5'-ATTGACAGTTTGACGGCGC-3' |
| 30 bp downstream | 5'-ATTGACAGTTTGACGGCGC-3' |
Dear Chonglin Yang, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Chonglin Yang -- WBPerson2241 |
| Your E-mail Address | clyang@ynu.edu.cn |
| PubMed ID | 40931112 |
| Allele Name | yq664 |
| Gene Name | moma-1 -- WBGene00019333 |
| Sequence Name | K02F3.10 |
| Type of Alteration | Point Mutation |
| Alteration Details | Loss of MOMA-1 |
| Mutation Details | W63stop |
| 30 bp upstream | W63stop |
| 30 bp downstream | W63stop |
| Reverse genetics | PCR |
Dear Antonio Miranda-Vizuete, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Antonio Miranda-Vizuete -- WBPerson3046 |
| Your E-mail Address | amiranda-ibis@us.es |
| PubMed ID | 16118202 |
| Allele Name | sa513 -- WBVar00242584 |
| Gene Name | nrf-5 -- WBGene00003812 |
| Sequence Name | F55B12.5 |
| Type of Alteration | Point Mutation |
| Alteration Details | Correct mutation C->A |
| Type of Mutation | Nonsense |
| Mutation Details | Previous reported mutation C->G |
| 30 bp upstream | ccgtttgcaacgtaactcattccgaacttt |
| 30 bp downstream | actggtgtttccacctggatcaagtttgtc |
| Strain | JT513 |
| Comment | We have sequenced the sa513 allele in the JT513 strain and found that the C->G mutation reported at Wormbase is incorrect. The correct mutation is C->A. We can of course provide the chromatogram and additional details if you request them by email. Looking forward to your reply, all the best. Antonio Miranda |
Dear Rehab Salama, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Rehab Salama -- WBPerson62243 |
| Your E-mail Address | rasalama@wpi.edu |
| PubMed ID | 40894620 |
| Allele Name | nch004 |
| Gene Name | odr-3 -- WBGene00003850 |
| Sequence Name | C34D1.3 |
| Type of Alteration | Point Mutation |
| Type of Mutation | Missense |
| Mutation Details | A>G |
| 30 bp upstream | GTTTCTGCAATGTGCACTATTTTAAGAGCT |
| 30 bp downstream | TGGACGGAGTTCTGCATTTACCGTTGGAAA |
Dear Rehab Salama, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Rehab Salama -- WBPerson62243 |
| Your E-mail Address | rasalama@wpi.edu |
| Allele Name | nch005 |
| Gene Name | odr-3 -- WBGene00003850 |
| Sequence Name | C34D1.3 |
| Type of Alteration | Point Mutation |
| Type of Mutation | Missense |
| Mutation Details | T>C |
| 30 bp upstream | AATTGAACTTGAATCCTGATAAAAAGACAA |
| 30 bp downstream | TTATATGCATGAAACTTGCGCTACAGACAC |
Dear Rehab Salama, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Rehab Salama -- WBPerson62243 |
| Your E-mail Address | rasalama@wpi.edu |
| Allele Name | nch012 |
| Gene Name | odr-3 -- WBGene00003850 |
| Sequence Name | C34D1.3 |
| Type of Alteration | Point Mutation |
| Type of Mutation | Missense |
| Mutation Details | C>T |
| 30 bp upstream | TACTCGGTGCAGGAGAATGTGGAAAATCTA |
| 30 bp downstream | AGTTCTGAAACAGATGCAgtatgttgaatc |
Dear Rehab Salama, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Rehab Salama -- WBPerson62243 |
| Your E-mail Address | rasalama@wpi.edu |
| Allele Name | nch011 |
| Gene Name | odr-3 -- WBGene00003850 |
| Sequence Name | C34D1.3 |
| Type of Alteration | Point Mutation |
| Mutation Details | A>T |
| 30 bp upstream | CTGAACCTGGGTATCGGCCAAAtGATCAAG |
| 30 bp downstream | TATCTTTATTCTCGAGTGGCAACAACTGG |
Dear Rehab Salama, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Rehab Salama -- WBPerson62243 |
| Your E-mail Address | raslama@wpi.edu |
| Allele Name | nch009 |
| Gene Name | odr-3 -- WBGene00003850 |
| Sequence Name | C34D1.3 |
| Type of Alteration | Point Mutation |
| Mutation Details | G>C |
| 30 bp upstream | AAAAAGACAATTTATATGCATGAAACTTGC |
| 30 bp downstream | CTACAGACACTAATCAGgtaggttattcct |
Dear Rehab Salama, thank you for submitting Allele-Sequence data.
A WormBase curator will be in touch if there are any questions.
| Your Name | Rehab Salama -- WBPerson62243 |
| Your E-mail Address | rasalama@wpi.edu |
| Allele Name | nch010 |
| Gene Name | odr-3 -- WBGene00003850 |
| Sequence Name | C34D1.3 |
| Type of Alteration | Point Mutation |
| Type of Mutation | Missense |
| Mutation Details | T>A |
| 30 bp upstream | aaaaaaaaaacttaattcgcaattttcagG |
| 30 bp downstream | ACAACTTGTtATTTCGAGTGTTATTGATAC |